View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12624_low_20 (Length: 242)
Name: NF12624_low_20
Description: NF12624
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12624_low_20 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 1 - 235
Target Start/End: Complemental strand, 38162271 - 38162037
Alignment:
| Q |
1 |
taaactcttctttactttctctctcctccttcacaccgccattgccgacgatggcgcgttcatgtcaaaactcgcgaaatctctcactccacctccgtca |
100 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38162271 |
taaactcttctttactttctctttcctccttcacaccgccattgccgacgatggcgcgttcatgtcaaaactcgcgaaatctctcactccacctccgtca |
38162172 |
T |
|
| Q |
101 |
ggttggtcgggaaactcgttttgcagctggaacggtgtgaaatgcgacggttcagaccgtgttacgtcgttaaacttggcttcgaaatcactcaccggaa |
200 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38162171 |
gggtggtcgggaaactcgttttgcagctggaacggtgtgaaatgcgacggttcagaccgtgttacgtcgttaaacttggcttcgaaatcactcaccggaa |
38162072 |
T |
|
| Q |
201 |
cattaccttccgatctgaactcactctctctgctc |
235 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||| |
|
|
| T |
38162071 |
cattaccttccgatctgaactcactctctcagctc |
38162037 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University