View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12624_low_7 (Length: 399)
Name: NF12624_low_7
Description: NF12624
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12624_low_7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 162; Significance: 2e-86; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 162; E-Value: 2e-86
Query Start/End: Original strand, 159 - 360
Target Start/End: Original strand, 3435390 - 3435592
Alignment:
| Q |
159 |
atttgtgtgttctaagaaatgaaagtttacttagttttttaataacattnnnnnnntaaaggagccaacttcatttccaaaacgaatctttttacaa-aa |
257 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
3435390 |
atttgtgtgttctaagagatgaaagtttacttagttttttaataacattaaaaaaataaaggagccaacttcatttccaaaacgaatctttttacaacaa |
3435489 |
T |
 |
| Q |
258 |
cgatttcgtaatatatattttaaatgaaatctcaacattagttatttttgggataataaaaattggattaaagagagtataagagatactattgcgtgga |
357 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
3435490 |
cgatttcgtaatatatattttaaatggaatctcaacattagttatttttgggataataaaaattggattaaagagagtataagagatactattgcatgga |
3435589 |
T |
 |
| Q |
358 |
ata |
360 |
Q |
| |
|
||| |
|
|
| T |
3435590 |
ata |
3435592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 17 - 72
Target Start/End: Original strand, 3435249 - 3435304
Alignment:
| Q |
17 |
catagggggtatggtgaatgcttgtaattggtcacggggatagaaaattaacgaac |
72 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
3435249 |
catagggggtatggtgaatgcttataattggtcacggggatagaaaattaacgaac |
3435304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University