View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12625_high_2 (Length: 246)
Name: NF12625_high_2
Description: NF12625
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12625_high_2 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 67; Significance: 7e-30; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 19 - 89
Target Start/End: Complemental strand, 30880634 - 30880564
Alignment:
| Q |
19 |
tcaatttgatgcttaaaacaaatttatcttctatacacagtttcgtacccgggagaattttctgaatgaga |
89 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
30880634 |
tcaatttgatgcttaaaacaaatttatcttctatacacagttacgtacccgggagaattttctgaatgaga |
30880564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 19 - 134
Target Start/End: Original strand, 44732160 - 44732275
Alignment:
| Q |
19 |
tcaatttgatgcttaaaacaaatttatcttctatacacagtttcgtacccgggagaattttctgaatgagacccttgtgtgattagctttgtgccatgga |
118 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||| || | ||| |||| |||||||||||||| ||||| ||||||||||||||| |||| ||||| |
|
|
| T |
44732160 |
tcaatttgaagcttaaaacaaatttatcttctataacaagctacgtgcccgagagaattttctgaacgagactcttgtgtgattagctaggtgctatgga |
44732259 |
T |
 |
| Q |
119 |
caaattttctgtcaag |
134 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
44732260 |
caaattttctgtcaag |
44732275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 181 - 235
Target Start/End: Original strand, 30877948 - 30878002
Alignment:
| Q |
181 |
tgtgtcagagttgttttggagtgtgatagtgatgaaaatgacagtgtcagtgaac |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30877948 |
tgtgtcagagttgttttggagtgtgatagtgatgaaaatgacagtgtcagtgaac |
30878002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 134 - 181
Target Start/End: Complemental strand, 30880544 - 30880497
Alignment:
| Q |
134 |
gggggctttaattacaacaagttaaaatattaatgcaaaggatgcctt |
181 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
30880544 |
gggggctttaattacaaaaagttaaaatattaatgcaaaggatgcctt |
30880497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University