View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12625_low_1 (Length: 410)
Name: NF12625_low_1
Description: NF12625
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12625_low_1 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 227; Significance: 1e-125; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 128 - 390
Target Start/End: Original strand, 23072202 - 23072464
Alignment:
| Q |
128 |
tatgcaacatacgtttatctgcttctgaacctttttaggcctcttaatgggcctctgccgcggtgcacgacccaaaaacgtcatgaaatcttcctccttt |
227 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
23072202 |
tatgcgacatacgtttatctgcttctgaacctttttaggcctcttaatgggcctctgccgcggtgcacgacccaaaaacgtcaagaaatcttcctccttt |
23072301 |
T |
 |
| Q |
228 |
tccttccttaaaataggaatgcaaaattttggcatttcgatcttattactatcaacattacttctcaaccttgtcgacacaaggtcatcgtctctggcca |
327 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||| | ||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
23072302 |
tccttccttgaaataggaatgcaaaattttggcctttcgatcttattactatcaacaatgcttctcaaccttgacgacacaaggtcatcgtctctggcca |
23072401 |
T |
 |
| Q |
328 |
cgacaccatcatttctcactagagaagcggtaattggagctttcatcactcttttttgcctac |
390 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
23072402 |
cgacaccatcatttctcacttgagaagcggtaattggagctttcatcactcttttttgtctac |
23072464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 1 - 36
Target Start/End: Original strand, 23072096 - 23072131
Alignment:
| Q |
1 |
taacctctcttaaccacaatccagggaaaaccttct |
36 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||| |
|
|
| T |
23072096 |
taacctctcttaaccacagtccagggaaaaccttct |
23072131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 1 - 39
Target Start/End: Original strand, 6963640 - 6963678
Alignment:
| Q |
1 |
taacctctcttaaccacaatccagggaaaaccttctgca |
39 |
Q |
| |
|
||||||| ||||||||||||||||||||||| ||||||| |
|
|
| T |
6963640 |
taacctcccttaaccacaatccagggaaaacattctgca |
6963678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University