View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12625_low_3 (Length: 214)
Name: NF12625_low_3
Description: NF12625
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12625_low_3 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 174; Significance: 8e-94; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 174; E-Value: 8e-94
Query Start/End: Original strand, 10 - 203
Target Start/End: Complemental strand, 37831906 - 37831713
Alignment:
| Q |
10 |
tcgttcactgagtttgttagacagataatcattgctaagttgtttttctgcttgttattttcaaggccaaaggatgtttaacttcctttagttatatatg |
109 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37831906 |
tcgttcactgagtttgttagacagataattgttgctaagttgtttttctgcttgttactttcaaggccaaaggatgtttaacttcctttagttatatatg |
37831807 |
T |
|
| Q |
110 |
attatcgttttcaattctttcacgatctttttgctaatgttaaacattcatataaaacaggttactattatgtggagtccagtgatgtccatct |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||| |
|
|
| T |
37831806 |
attatcgttttcaattctttcacgatctttttgctaatgttaaacattcatataaaacaggttactattatgtggagtccagtgttgttcatct |
37831713 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University