View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12626_high_2 (Length: 250)
Name: NF12626_high_2
Description: NF12626
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12626_high_2 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 4 - 242
Target Start/End: Complemental strand, 12925690 - 12925450
Alignment:
| Q |
4 |
tgtgtgacgcaattacaattgcgtgatggagttacagtaggaaatcccattccaatttattgggattttaggccagaagaagtccacattctctgctnnn |
103 |
Q |
| |
|
|||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12925690 |
tgtgtgacgcaattacaactgcgtgatgcagttacagtaggaaatcccattccaatttattgggattttaggccagaagaagtccacattctctgctaaa |
12925591 |
T |
 |
| Q |
104 |
nnnnnn-tcatgggcatcatgaatggaccttatagtattttatatctttaccttttcccttttggttggatctatatagattatgcataaggctctgcaa |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
12925590 |
aaaaaaatcatgggcatcatgaatggaccttatagtattttatatctttaccttttcccttttggttgtatctatatagattatgcataaggctctgcaa |
12925491 |
T |
 |
| Q |
203 |
acaattaatagtttatgataca-aaaaggatatcctttgct |
242 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
12925490 |
acaattaatagtttatgatacaaaaaaggatatcctttgct |
12925450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University