View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12626_low_11 (Length: 217)
Name: NF12626_low_11
Description: NF12626
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12626_low_11 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 164; Significance: 8e-88; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 19 - 210
Target Start/End: Original strand, 52697861 - 52698049
Alignment:
| Q |
19 |
gataggcatggtaggattgctgataaacgaacaactggaggatggaaggcagctccctatatcatatgtatgaaataaatactactctacattatgaaat |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
52697861 |
gataggcatggtaggattgctgataaacgaacaactggaggatggaaggcagctccctatatcatatgtatgaaataaatactactcaacattatgaaat |
52697960 |
T |
|
| Q |
119 |
tagatatatagaatcataatgtatattgtttttgtatttggtagtatctatatattaactttgaactgttttatggatttt-cagtgaacgag |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
52697961 |
tagatatatagaatcataatgtatattgtttttgtatttggtagtatc----tattaactttgaactgttttatggattttccagtgaacgag |
52698049 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 23 - 103
Target Start/End: Original strand, 52720415 - 52720495
Alignment:
| Q |
23 |
ggcatggtaggattgctgataaacgaacaactggaggatggaaggcagctccctatatcatatgtatgaaataaatactac |
103 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||| ||||||| |||||||||| |
|
|
| T |
52720415 |
ggcatggtaggattgctgataaaagaacaactggaggatggaaggcagctcccttcatcataagtatgaactaaatactac |
52720495 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 23 - 103
Target Start/End: Original strand, 52711525 - 52711605
Alignment:
| Q |
23 |
ggcatggtaggattgctgataaacgaacaactggaggatggaaggcagctccctatatcatatgtatgaaataaatactac |
103 |
Q |
| |
|
|||| |||||||||||| ||||| ||||||| |||||||||||||||||||||| |||||| ||||||| |||||||||| |
|
|
| T |
52711525 |
ggcaaggtaggattgctaataaaagaacaaccggaggatggaaggcagctcccttcatcataagtatgaactaaatactac |
52711605 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University