View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12626_low_12 (Length: 214)
Name: NF12626_low_12
Description: NF12626
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12626_low_12 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 167; Significance: 1e-89; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 14 - 196
Target Start/End: Original strand, 2895473 - 2895655
Alignment:
| Q |
14 |
gttcactgataaatggaaaagtcactcgctgtttcccccaacaaccacaggtatggcatagggataatcttgtacactatactgtattatttaaacacaa |
113 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
2895473 |
gttcgctgataaatggaaaagtcactcgctgttgcccccaacaaccacaggtatggcatagggataatcttgtacactatactgtattatttaaacgcaa |
2895572 |
T |
|
| Q |
114 |
gttgtaatttttaaccctaagctaaaacaatagaaaatcattgcaaccatgcagtcggagccgtaggcacaattgaccaaact |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
2895573 |
gttgtaatttttaaccctaagctaaaacaatagaaaatcattgcaaccatgcagtcggagccgtagacacaattgaccaaact |
2895655 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 97 - 158
Target Start/End: Complemental strand, 2888861 - 2888800
Alignment:
| Q |
97 |
gtattatttaaacacaagttgtaatttttaaccctaagctaaaacaatagaaaatcattgca |
158 |
Q |
| |
|
||||||||||||||||||||||||| | |||| ||||||| || ||||||||||||||||| |
|
|
| T |
2888861 |
gtattatttaaacacaagttgtaatctgtaactctaagcttgaataatagaaaatcattgca |
2888800 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University