View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12628_high_2 (Length: 320)
Name: NF12628_high_2
Description: NF12628
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12628_high_2 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 264; Significance: 1e-147; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 264; E-Value: 1e-147
Query Start/End: Original strand, 20 - 307
Target Start/End: Original strand, 17400520 - 17400806
Alignment:
| Q |
20 |
gctgaaaaaatgagaattcgcgcggaagagttccttgcagaatctcacaataacttgcttcactattttgactcgtaagcaagagatatcaaaaggataa |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
17400520 |
gctgaaaaaatgagaattcgcgcggaagagttccttgcagaatctcacaataacttgcttcactattttgactcttaagcaagagatatcaaaaggataa |
17400619 |
T |
 |
| Q |
120 |
gttactgtgatttttagtaataaatcacctattgttaaggtgacactaaactcatggagtattttcttttagtatgaaagagtacatttctttatatttt |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
17400620 |
gttactgtgatttttagtaataaatcacctattgttaaggtgacactaaactcatggagtattttcttttagtttgaaaaagtacatttctttatatttt |
17400719 |
T |
 |
| Q |
220 |
aatatttatggttatggttggatacttttactgttttggatgatatgaatggatgatacttatcccgtcaaaattcttagctatatct |
307 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
17400720 |
aatatttatggttatggttggatacttttactg-tttggatgatatgaatggatgatacttatcccttcaaaattcttagctatatct |
17400806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University