View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12628_low_6 (Length: 244)
Name: NF12628_low_6
Description: NF12628
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12628_low_6 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 18 - 244
Target Start/End: Original strand, 7905651 - 7905877
Alignment:
| Q |
18 |
ttctaaatgcaagaaatgtagattttatagtatcaccaaagcttcttagaagtttgtgaaattcttctctaacaaaagaatcaacttcttctatgaacaa |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||| ||||||| |
|
|
| T |
7905651 |
ttctaaatgcaagaaatgtagattttatagtatcaccaaagcttcttagaagtttgtgaaattctcctctgacaaaagaatcaacttcttcaatgaacag |
7905750 |
T |
 |
| Q |
118 |
aatatctatatccactgctagaagttccaaaacctcatacatgtctagcaaacaaaacagtttttcgggtgtgtgtgttcccattgttatggcctcacca |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7905751 |
aatatctatatccactgctagaagttccaaaacctcatacatgtcaagcaaacaaaacagtttttcgggtgtgtgtgttcccattgttatggcctcacca |
7905850 |
T |
 |
| Q |
218 |
aaatttaaaaggcacaagactgaactc |
244 |
Q |
| |
|
|||||||||||||||||||| |||||| |
|
|
| T |
7905851 |
aaatttaaaaggcacaagaccgaactc |
7905877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University