View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1262_high_22 (Length: 393)
Name: NF1262_high_22
Description: NF1262
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1262_high_22 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 318; Significance: 1e-179; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 318; E-Value: 1e-179
Query Start/End: Original strand, 14 - 335
Target Start/End: Original strand, 36603882 - 36604203
Alignment:
| Q |
14 |
agagccccaccgatccataaaacaccgagacagagaaacgatcaactatcatctctatctttttgtttgggtttgttatgtttagttcaacctcgaacat |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36603882 |
agagccccaccgatccataaaacaccgagacagagaaacgatcaactatcatctctatctttttgtttgggtttgttatgtttagttcaacctcgaacat |
36603981 |
T |
 |
| Q |
114 |
gccttttagctctgaatcagagacagtgaagttggacacagagattgagctgactcgaaaatgaggtttatgtgggtccatgacattccaagctatagcg |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
36603982 |
gccttttagctctgaatcagagacagtgaagttggacacagagattgagctgactcgaaaatgagttttatgtgggtccatgacattccaagctatagcg |
36604081 |
T |
 |
| Q |
214 |
atgatgacagttaaagtgagaaagagtaaaatgaatgtccaggtaagtcgacggactacaccgagagtagaggaccccggtgtcctagaagaagcattgg |
313 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36604082 |
atgatgacagttaaagtgagaaagagtaaaatgaatgtccaggtaagtcgacggactacaccgagagtagaggaccccggtgtcctagaagaagcattgg |
36604181 |
T |
 |
| Q |
314 |
tgctggtatgaggaggctgagg |
335 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
36604182 |
tgctggtatgaggaggctgagg |
36604203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University