View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1262_high_29 (Length: 346)
Name: NF1262_high_29
Description: NF1262
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1262_high_29 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 75 - 317
Target Start/End: Complemental strand, 36980182 - 36979948
Alignment:
| Q |
75 |
ataatacttcaggttatatcaattatataaatattttttcgtgcatgtctctaaaggcatgtatcatggcttttcataaaatttgttaactggacttaaa |
174 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
36980182 |
ataatacttcaggttatatcaattatataaatattttttcgtgcatgtctctaaaggcatgtatcatggcttttcataa--tttgttaactggacttaaa |
36980085 |
T |
 |
| Q |
175 |
tttcttattgtaaggacttgtattatggttgatctttctatctggatcccactttgcatataaatgatgtaactatcatgttgtcgtaacttttttgtgt |
274 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
36980084 |
tttcttattgtaaggacttgtattatggttgatctttctatctggatcccactttgcatataaatgatgtaactatcatgttgtcgtaacatttttgtgt |
36979985 |
T |
 |
| Q |
275 |
ttgtaattgttggctggtttatatgagtgaaacactttaatgt |
317 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36979984 |
------ttgttggctggtttatatgagtgaaacactttaatgt |
36979948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University