View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1262_high_30 (Length: 332)
Name: NF1262_high_30
Description: NF1262
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1262_high_30 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 87; Significance: 1e-41; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 195 - 304
Target Start/End: Original strand, 40576784 - 40576894
Alignment:
| Q |
195 |
aagtgattggatgtgataaatgtgtcagtgtcgcgaagtgtcggtgctactgtaagagaccttaagttgatgga-tcttcatatactttaggggctaaat |
293 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
40576784 |
aagtgattggatgtaataaatgtgtcagtgtcgtgaagtgtcggtgctactttaagagaccttaagttgatggatttttcatatactttaggggctaaat |
40576883 |
T |
 |
| Q |
294 |
tgaaagatttt |
304 |
Q |
| |
|
||||||||||| |
|
|
| T |
40576884 |
tgaaagatttt |
40576894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 84; E-Value: 7e-40
Query Start/End: Original strand, 13 - 107
Target Start/End: Original strand, 40576679 - 40576774
Alignment:
| Q |
13 |
aatattacccttccattcgcctgcaggcatggtacttacttttatcttcaaattatgactgtatcttgatta-tttaaacttatgcaaatcatcat |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
40576679 |
aatattacccttccattcgcctgcaggcatggtacttacttttatcttcaaattatgagtgtatcttgattattttaaacttatgcaaatcatcat |
40576774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University