View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1262_high_31 (Length: 314)
Name: NF1262_high_31
Description: NF1262
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1262_high_31 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 265; Significance: 1e-148; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 265; E-Value: 1e-148
Query Start/End: Original strand, 13 - 285
Target Start/End: Original strand, 36235616 - 36235888
Alignment:
| Q |
13 |
aatatcataataatgagataattattaacaaaaatgtaaacatcatccggctatttttgacaatcacgaaaatttgtaattaatttatgggggagaaaga |
112 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36235616 |
aatatcataataatgagataattattaaccaaaatgtaaacatcatccggctatttttgacaatcacgaaaatttgtaattaatttatgggggagaaaga |
36235715 |
T |
 |
| Q |
113 |
aacaaaatgcaacatcttttcaagtaaagattagaagtgattgctgcaacaatgaaggcatatggaatcttgatctgaacgtcattaaccccaccagaat |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36235716 |
aacaaaatgcaacatcttttcaagtaaagattagaagtgattgctgcaacaatgaaggcatatggaatcttgatctgaacgtcattaaccccaccagaat |
36235815 |
T |
 |
| Q |
213 |
gtgaaagaaagcacattgcaattttctactactaatgtggtcgtgtttgtgattaatttccttggataggaag |
285 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36235816 |
gtgaaagaaagcacgttgcaattttctactactaatgtggtcgtgtttgtgattaatttccttggataggaag |
36235888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University