View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1262_high_48 (Length: 258)
Name: NF1262_high_48
Description: NF1262
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1262_high_48 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 12 - 230
Target Start/End: Original strand, 6932713 - 6932931
Alignment:
| Q |
12 |
atgaatctagtggaagtggaatggatggagaaggagcaagttatcttgttcatgaaattacacagatcacaaaacttaggtcaagtccacatgagaattt |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6932713 |
atgaatctagtggaagtggaatggatggagaaggagcaagttatcttgttcatgaaattgcacagatcacaaaacttaggtcaagtccacatgagaattt |
6932812 |
T |
 |
| Q |
112 |
gagtcgtgttgttcctggtatggggaaattacctgcatcaactgtaagaatgttggtaggcagagaaggtaatttttctggaagagggaaattttcagca |
211 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6932813 |
gagtcgggttgttcctggtatggggaaattacctgcatcaactgtaagaatgttggtaggcagagaaggtaatttttctggaagagggaaattttcagca |
6932912 |
T |
 |
| Q |
212 |
gctgatcggtgtcatatgt |
230 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
6932913 |
gctgatcggtgtcatatgt |
6932931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University