View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1262_high_53 (Length: 244)

Name: NF1262_high_53
Description: NF1262
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1262_high_53
NF1262_high_53
[»] chr1 (1 HSPs)
chr1 (24-198)||(43979572-43979746)
[»] chr3 (1 HSPs)
chr3 (199-227)||(29199690-29199718)


Alignment Details
Target: chr1 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 24 - 198
Target Start/End: Complemental strand, 43979746 - 43979572
Alignment:
24 gatagggaggtcaattttgcgaacaaggtcagcgaggaagatgaatgcgccagtgataacgccgacgaagacgggaggaggtgaagaagcagtaaaatca 123  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||    
43979746 gatagggaggtcaattttgcgaacaaggtcagcgaggaagatgaatgcgccagtgataacgccgacgaagacgggaggaggtgaagaagcaggaaaatca 43979647  T
124 tgatcgatttgatcggcgagttgggagactcgtagggagatttggtcttggttccagaggattctgtctctgtgg 198  Q
    ||| |||||||| ||||||||||||||||||| || |||||||||||||||||||| |||||||| ||| |||||    
43979646 tgaacgatttgagcggcgagttgggagactcggagagagatttggtcttggttccaaaggattctttctatgtgg 43979572  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 199 - 227
Target Start/End: Original strand, 29199690 - 29199718
Alignment:
199 tgctgcattatgtgttttgtttatgtaag 227  Q
    |||||||||||||||||||||||||||||    
29199690 tgctgcattatgtgttttgtttatgtaag 29199718  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University