View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1262_low_53 (Length: 320)
Name: NF1262_low_53
Description: NF1262
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1262_low_53 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 117; Significance: 1e-59; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 129 - 257
Target Start/End: Original strand, 47583347 - 47583475
Alignment:
| Q |
129 |
aacaggtacgtgtcagttgccatgcagtgttactaattgctgctaactcatgttaacctaaatctcacttaacaagaatttaattggactattgtcaata |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47583347 |
aacaggtacgtgtcagttgccatgcagtgttactaattgctgctaactcatgttaacctaaatctcacttaacaagaatttaattggactattgtcaata |
47583446 |
T |
 |
| Q |
229 |
ttgggcttcatgcttttgattttgttgga |
257 |
Q |
| |
|
|||||| ||||| ||||||||||| |||| |
|
|
| T |
47583447 |
ttgggcctcatggttttgattttgatgga |
47583475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University