View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1262_low_55 (Length: 314)
Name: NF1262_low_55
Description: NF1262
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1262_low_55 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 267; Significance: 1e-149; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 267; E-Value: 1e-149
Query Start/End: Original strand, 11 - 285
Target Start/End: Original strand, 36235614 - 36235888
Alignment:
| Q |
11 |
ataatatcataataatgagataattattaacaaaaatgtaaacatcatccggctatttttgacaatcacgaaaatttgtaattaatttatgggggagaaa |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36235614 |
ataatatcataataatgagataattattaaccaaaatgtaaacatcatccggctatttttgacaatcacgaaaatttgtaattaatttatgggggagaaa |
36235713 |
T |
|
| Q |
111 |
gaaacaaaatgcaacatcttttcaagtaaagattagaagtgattgctgcaacaatgaaggcatatggaatcttgatctgaacgtcattaaccccaccaga |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36235714 |
gaaacaaaatgcaacatcttttcaagtaaagattagaagtgattgctgcaacaatgaaggcatatggaatcttgatctgaacgtcattaaccccaccaga |
36235813 |
T |
|
| Q |
211 |
atgtgaaagaaagcacattgcaattttctactactaatgtggtcgtgtttgtgattaatttccttggataggaag |
285 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36235814 |
atgtgaaagaaagcacgttgcaattttctactactaatgtggtcgtgtttgtgattaatttccttggataggaag |
36235888 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University