View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1262_low_59 (Length: 296)

Name: NF1262_low_59
Description: NF1262
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1262_low_59
NF1262_low_59
[»] chr4 (1 HSPs)
chr4 (176-282)||(34637821-34637927)


Alignment Details
Target: chr4 (Bit Score: 107; Significance: 1e-53; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 176 - 282
Target Start/End: Original strand, 34637821 - 34637927
Alignment:
176 aaaaatagtaccgattaaacgatccaggataaataaattataaaaaattattcttctatatttcatgaagccctttaatattgaaatatcccaattacgc 275  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34637821 aaaaatagtaccgattaaacgatccaggataaataaattataaaaaattattcttctatatttcatgaagccctttaatattgaaatatcccaattacgc 34637920  T
276 acaggtt 282  Q
    |||||||    
34637921 acaggtt 34637927  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University