View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1262_low_59 (Length: 296)
Name: NF1262_low_59
Description: NF1262
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1262_low_59 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 107; Significance: 1e-53; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 176 - 282
Target Start/End: Original strand, 34637821 - 34637927
Alignment:
| Q |
176 |
aaaaatagtaccgattaaacgatccaggataaataaattataaaaaattattcttctatatttcatgaagccctttaatattgaaatatcccaattacgc |
275 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34637821 |
aaaaatagtaccgattaaacgatccaggataaataaattataaaaaattattcttctatatttcatgaagccctttaatattgaaatatcccaattacgc |
34637920 |
T |
|
| Q |
276 |
acaggtt |
282 |
Q |
| |
|
||||||| |
|
|
| T |
34637921 |
acaggtt |
34637927 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University