View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1262_low_61 (Length: 293)
Name: NF1262_low_61
Description: NF1262
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1262_low_61 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 96; Significance: 4e-47; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 96; E-Value: 4e-47
Query Start/End: Original strand, 12 - 130
Target Start/End: Original strand, 979114 - 979233
Alignment:
| Q |
12 |
aaaggcaaaaaggaaagccaaagaataaactcaaaggaacataattcggttggaaattgagatgtaaacagggga-aaaactctgagtattagaacccaa |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| | ||||| |||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
979114 |
aaaggcaaaaaggaaagccaaagaataaactcaaaggaacctgattcgattggaaattgagatgtaaacaggggataaaactctgagtattagaacccag |
979213 |
T |
 |
| Q |
111 |
gtattaatataaagtgattg |
130 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
979214 |
gtattaatataaagtgattg |
979233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 199 - 269
Target Start/End: Original strand, 979302 - 979372
Alignment:
| Q |
199 |
gtaccaactatccagaatctttctttcaactagattaaggaaggataacaaagtaagataagaggaaagag |
269 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
979302 |
gtaccaactatccagaatctgtctttcaactagattaaggaaggataacaaagtaagagaagaggaaagag |
979372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University