View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1262_low_68 (Length: 269)
Name: NF1262_low_68
Description: NF1262
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1262_low_68 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 29 - 222
Target Start/End: Complemental strand, 33511459 - 33511266
Alignment:
| Q |
29 |
acagagaatacagcagggttgcacgggtttgaaacgtctttgaataaaaaggaaaataaacgcacatgtgaggaaacatggtgaggtctagtgggtccca |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33511459 |
acagagaatacagcagggttgcacgggtttgaaacgtctttgaataaaaaggaaaataaatgcacatgtgaggaaacatggtgaggtctagtgggtccca |
33511360 |
T |
 |
| Q |
129 |
ctaaaatgacttggaaaaaaggtttatgtggtttacaaatagagggggatggatgatgctcacatgttggtgagaatgggaataaaaccatgga |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33511359 |
ctaaaatgacttggaaaaaaggtttatgtggtttacaaatagagggggatggatgatgctcacatgttggtgagaatgggaataaaaccatgga |
33511266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University