View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1262_low_74 (Length: 260)
Name: NF1262_low_74
Description: NF1262
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1262_low_74 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 100; Significance: 1e-49; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 1 - 100
Target Start/End: Complemental strand, 10101539 - 10101440
Alignment:
| Q |
1 |
gttgttatgctacaaagtgtagcttttgccaagatcacaatggcttgccgtgattttgcctaattcatcgttgattcaaacacacactaaagtattatct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10101539 |
gttgttatgctacaaagtgtagcttttgccaagatcacaatggcttgccgtgattttgcctaattcatcgttgattcaaacacacactaaagtattatct |
10101440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 7 - 84
Target Start/End: Original strand, 10214063 - 10214140
Alignment:
| Q |
7 |
atgctacaaagtgtagcttttgccaagatcacaatggcttgccgtgattttgcctaattcatcgttgattcaaacaca |
84 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||| ||||||||||||| |||||||| |||||||||||| |
|
|
| T |
10214063 |
atgctacaaagtgtagcttttgccaaaatcacaatggcttgcggtgattttgcctagttcatcgtcgattcaaacaca |
10214140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 179 - 260
Target Start/End: Original strand, 8401324 - 8401406
Alignment:
| Q |
179 |
ttatcctagatatacgagcgaataggtatatgaaaatgtactttatgttgatagttgcaaagaacaa-tttacaacctacaat |
260 |
Q |
| |
|
|||||||||||||| ||| ||||||||||||||||||||| | |||||||||||||| |||||| || ||||||| ||||||| |
|
|
| T |
8401324 |
ttatcctagatatatgagagaataggtatatgaaaatgtaatgtatgttgatagttgaaaagaaaaattttacaaactacaat |
8401406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 7 - 56
Target Start/End: Complemental strand, 10102044 - 10101995
Alignment:
| Q |
7 |
atgctacaaagtgtagcttttgccaagatcacaatggcttgccgtgattt |
56 |
Q |
| |
|
||||||| |||||||||||||||||| |||||||||||| |||||||||| |
|
|
| T |
10102044 |
atgctacgaagtgtagcttttgccaaaatcacaatggctcgccgtgattt |
10101995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University