View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1262_low_82 (Length: 250)
Name: NF1262_low_82
Description: NF1262
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1262_low_82 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 159; Significance: 9e-85; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 159; E-Value: 9e-85
Query Start/End: Original strand, 76 - 250
Target Start/End: Complemental strand, 37028321 - 37028147
Alignment:
| Q |
76 |
gagaatcaagaatgtatcattattcttcaaatcggcagaactaccaaaacacagatgataatggcttagccttcattgatgctgatcatgtcaagtttcc |
175 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37028321 |
gagaatcaagaatgtatcattattcttcaaatcagcagaactaccaaaacacagatgataatggcttagccttcattgatgctgatcatgtcaagtttcc |
37028222 |
T |
|
| Q |
176 |
aacacactcagatggttttatttcaaaagagaatgcgtcaactgatgaaaacaaagttcatccacttgtgaataa |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||| ||||||||||||||| |
|
|
| T |
37028221 |
aacacactcagatggttttatttcaaaagagaatgtgtcagctgatgaaaacaaagttcctccacttgtgaataa |
37028147 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University