View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1262_low_84 (Length: 244)
Name: NF1262_low_84
Description: NF1262
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1262_low_84 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 24 - 198
Target Start/End: Complemental strand, 43979746 - 43979572
Alignment:
| Q |
24 |
gatagggaggtcaattttgcgaacaaggtcagcgaggaagatgaatgcgccagtgataacgccgacgaagacgggaggaggtgaagaagcagtaaaatca |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
43979746 |
gatagggaggtcaattttgcgaacaaggtcagcgaggaagatgaatgcgccagtgataacgccgacgaagacgggaggaggtgaagaagcaggaaaatca |
43979647 |
T |
 |
| Q |
124 |
tgatcgatttgatcggcgagttgggagactcgtagggagatttggtcttggttccagaggattctgtctctgtgg |
198 |
Q |
| |
|
||| |||||||| ||||||||||||||||||| || |||||||||||||||||||| |||||||| ||| ||||| |
|
|
| T |
43979646 |
tgaacgatttgagcggcgagttgggagactcggagagagatttggtcttggttccaaaggattctttctatgtgg |
43979572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 199 - 227
Target Start/End: Original strand, 29199690 - 29199718
Alignment:
| Q |
199 |
tgctgcattatgtgttttgtttatgtaag |
227 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
29199690 |
tgctgcattatgtgttttgtttatgtaag |
29199718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University