View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1262_low_91 (Length: 211)
Name: NF1262_low_91
Description: NF1262
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1262_low_91 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 17 - 201
Target Start/End: Original strand, 14960250 - 14960438
Alignment:
| Q |
17 |
ctttgtagctttattcagcatacttggtttatggttcattgttgttctgagagcaatcaattcatggtt--------cccaatcatgagtactgcagttg |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
14960250 |
ctttgtagctttattcagcatacttggtttatggttcattgttgttctgagagcaatcaattcatggttgaatggttcccaatcatgagtactgcagttg |
14960349 |
T |
|
| Q |
109 |
gctaactaacttacttatggacatatttacttggtaacactatttgaagtttcttttttatgtaccatgaaaatgaacatgacctttgcttct |
201 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14960350 |
gctaa----cttacttatggacatatttacttggtaacactatttgaagtttcttttttatgtaccatgaaaatgaacatgacctttgcttct |
14960438 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University