View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1263-Insertion-10 (Length: 73)
Name: NF1263-Insertion-10
Description: NF1263
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1263-Insertion-10 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 60; Significance: 3e-26; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 60; E-Value: 3e-26
Query Start/End: Original strand, 8 - 67
Target Start/End: Complemental strand, 35631253 - 35631194
Alignment:
| Q |
8 |
gcaagtttaaaaaattataaagctgaatttgttgcatagaatgaataaaatggggcacaa |
67 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35631253 |
gcaagtttaaaaaattataaagctgaatttgttgcatagaatgaataaaatggggcacaa |
35631194 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 37; Significance: 0.000000000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 37; E-Value: 0.000000000001
Query Start/End: Original strand, 8 - 56
Target Start/End: Complemental strand, 16955989 - 16955941
Alignment:
| Q |
8 |
gcaagtttaaaaaattataaagctgaatttgttgcatagaatgaataaa |
56 |
Q |
| |
|
|||||||||||||| || ||| ||||||||||||||||||||||||||| |
|
|
| T |
16955989 |
gcaagtttaaaaaactaaaaatctgaatttgttgcatagaatgaataaa |
16955941 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University