View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1263-Insertion-11 (Length: 64)
Name: NF1263-Insertion-11
Description: NF1263
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1263-Insertion-11 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 54; Significance: 8e-23; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 54; E-Value: 8e-23
Query Start/End: Original strand, 7 - 64
Target Start/End: Original strand, 43409497 - 43409554
Alignment:
| Q |
7 |
accactatcacaagttgatgcagtttcaggctgttcaaccaaagacacttcatcatca |
64 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
43409497 |
accactatcacaagttgatgcagtttcaggttgttcaaccaaagacacttcatcatca |
43409554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University