View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1263-Insertion-12 (Length: 56)
Name: NF1263-Insertion-12
Description: NF1263
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1263-Insertion-12 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 47; Significance: 1e-18; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 47; E-Value: 1e-18
Query Start/End: Original strand, 7 - 53
Target Start/End: Complemental strand, 3104456 - 3104410
Alignment:
| Q |
7 |
attctgcacgaatatccgactcaaaaataattgaatccattgcatcg |
53 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3104456 |
attctgcacgaatatccgactcaaaaataattgaatccattgcatcg |
3104410 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University