View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1263-Insertion-13 (Length: 49)
Name: NF1263-Insertion-13
Description: NF1263
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1263-Insertion-13 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 30; Significance: 0.00000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000001
Query Start/End: Original strand, 8 - 37
Target Start/End: Original strand, 2165051 - 2165080
Alignment:
| Q |
8 |
aaacaaacaattttcactaatttctctctc |
37 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
2165051 |
aaacaaacaattttcactaatttctctctc |
2165080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University