View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1263-Insertion-6 (Length: 257)
Name: NF1263-Insertion-6
Description: NF1263
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1263-Insertion-6 |
 | |
|
| [»] scaffold0147 (2 HSPs) |
| | |
|
Alignment Details
Target: scaffold0147 (Bit Score: 134; Significance: 8e-70; HSPs: 2)
Name: scaffold0147
Description:
Target: scaffold0147; HSP #1
Raw Score: 134; E-Value: 8e-70
Query Start/End: Original strand, 7 - 140
Target Start/End: Complemental strand, 13310 - 13177
Alignment:
| Q |
7 |
ataagggagcacatgtgttagcacagaagatgaagaaaatggatatgatggaatcaggtgatcttgaacatgtgctagacatagaagaagcacttcacta |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13310 |
ataagggagcacatgtgttagcacagaagatgaagaaaatggatatgatggaatcaggtgatcttgaacatgtgctagacatagaagaagcacttcacta |
13211 |
T |
|
| Q |
107 |
ctattctcgccttaaaagtccagtttatctcgat |
140 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
13210 |
ctattctcgccttaaaagtccagtttatctcgat |
13177 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0147; HSP #2
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 7 - 136
Target Start/End: Complemental strand, 7726 - 7597
Alignment:
| Q |
7 |
ataagggagcacatgtgttagcacagaagatgaagaaaatggatatgatggaatcaggtgatcttgaacatgtgctagacatagaagaagcacttcacta |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| || | ||||||||||| ||||||||||||||||| || |||||||| ||||||||||||||||| |
|
|
| T |
7726 |
ataagggagcacatgtgttagcacagaagatgaaggaattagatatgatggattcaggtgatcttgaacacgtactagacatcgaagaagcacttcacta |
7627 |
T |
|
| Q |
107 |
ctattctcgccttaaaagtccagtttatct |
136 |
Q |
| |
|
||||||||||||||||||||| |||||||| |
|
|
| T |
7626 |
ctattctcgccttaaaagtccggtttatct |
7597 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 40; Significance: 0.00000000000009; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 32 - 115
Target Start/End: Original strand, 43879078 - 43879161
Alignment:
| Q |
32 |
gaagatgaagaaaatggatatgatggaatcaggtgatcttgaacatgtgctagacatagaagaagcacttcactactattctcg |
115 |
Q |
| |
|
|||||||||| || |||| |||| || ||||||||| ||||||| || ||||| |||||||||||||||||||| |||||||| |
|
|
| T |
43879078 |
gaagatgaaggaattggagatgaatgattcaggtgatgttgaacaagtactagatatagaagaagcacttcactattattctcg |
43879161 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 16597 times since January 2019
Visitors: 1282