View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1263-Insertion-9 (Length: 150)
Name: NF1263-Insertion-9
Description: NF1263
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1263-Insertion-9 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 115; Significance: 9e-59; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 115; E-Value: 9e-59
Query Start/End: Original strand, 8 - 141
Target Start/End: Original strand, 11237329 - 11237465
Alignment:
| Q |
8 |
gaatcctcttcattttgaggtatatatgtctcctttttgtgtctt---cattatctactatctttgttgtcttatgttgatttctgcatcgcctattgta |
104 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
11237329 |
gaattctcttcattttgaggtatatatgtctcctttttgtgtcttcttcattatctactatctttgttgtcttatgtcgatttctgcatcgcctattgta |
11237428 |
T |
|
| Q |
105 |
atttgtagagttgaacttcttttaatactatgtattt |
141 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11237429 |
atttgtagagttgaacttcttttaatactatgtattt |
11237465 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University