View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12631_low_9 (Length: 225)
Name: NF12631_low_9
Description: NF12631
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12631_low_9 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 1 - 184
Target Start/End: Complemental strand, 31563933 - 31563750
Alignment:
| Q |
1 |
cggcagtattaccaaaaggtgtgaacgaaggtggctcatggggaagaggattcatcctgcctggaggaggtcttaaaggtggcattccagaatggatagt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31563933 |
cggcagtattaccaaaaggtgtgaacgaaggtggctcatggggaagaggattcatcctgcctggaggaggtcttaaaggtggcattccagaatggatagt |
31563834 |
T |
|
| Q |
101 |
tcccactctcccaggaggaggattcaattcaaatggcgatccgacagcagcaaaagctcccatcgattgatttccttgcagtga |
184 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31563833 |
tcccactctcccaggaggaggattcaattcaaatggcgatccgacaacagcaaaagctcccatcgattgatttccttgcagtga |
31563750 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University