View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12633_low_11 (Length: 221)
Name: NF12633_low_11
Description: NF12633
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12633_low_11 |
 | |
|
| [»] scaffold0161 (1 HSPs) |
| | |
|
Alignment Details
Target: chr5 (Bit Score: 170; Significance: 2e-91; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 20 - 205
Target Start/End: Complemental strand, 32457353 - 32457168
Alignment:
| Q |
20 |
ttagaaagagcagccactgtctatggcaactccatttccatcatatacaacaacacttcattcacttggtctcaaacccacaaaagatgtcttcaacttg |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32457353 |
ttagaaagagcagccactgtctatggcaactccatttcaatcatatacaacaatacctcattcacttggtctcaaacccacaaaagatgtcttcaacttg |
32457254 |
T |
|
| Q |
120 |
cttcatcactttcttccctcggcatccaaaaaggcgatgtcgtctccgtcctttcccccaacactccggccatgtatgagcttcat |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
32457253 |
cttcatcactttcttccctcggcatccaaaaaggcgatgtcgtctccgtcctttcccccaacactccggccatgtacgagcttcat |
32457168 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 20 - 205
Target Start/End: Original strand, 32463782 - 32463967
Alignment:
| Q |
20 |
ttagaaagagcagccactgtctatggcaactccatttccatcatatacaacaacacttcattcacttggtctcaaacccacaaaagatgtcttcaacttg |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32463782 |
ttagaaagagcagccactgtctatggcaactccatttcaatcatatacaacaatacctcattcacttggtctcaaacccacaaaagatgtcttcaacttg |
32463881 |
T |
|
| Q |
120 |
cttcatcactttcttccctcggcatccaaaaaggcgatgtcgtctccgtcctttcccccaacactccggccatgtatgagcttcat |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32463882 |
cttcatcactttcttccctcggcatccaaaaaggcgacgtcgtctccgtcctttcccccaacactccggccatgtatgagcttcat |
32463967 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0161 (Bit Score: 122; Significance: 9e-63; HSPs: 1)
Name: scaffold0161
Description:
Target: scaffold0161; HSP #1
Raw Score: 122; E-Value: 9e-63
Query Start/End: Original strand, 20 - 201
Target Start/End: Original strand, 23206 - 23387
Alignment:
| Q |
20 |
ttagaaagagcagccactgtctatggcaactccatttccatcatatacaacaacacttcattcacttggtctcaaacccacaaaagatgtcttcaacttg |
119 |
Q |
| |
|
||||| |||||||| |||||||||||||||||||| || ||||||||||||| |||||||||||| |||| ||||||||| ||| ||||||||||||||| |
|
|
| T |
23206 |
ttagacagagcagctactgtctatggcaactccatatcaatcatatacaacagcacttcattcacatggtttcaaacccataaacgatgtcttcaacttg |
23305 |
T |
|
| Q |
120 |
cttcatcactttcttccctcggcatccaaaaaggcgatgtcgtctccgtcctttcccccaacactccggccatgtatgagct |
201 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||| |||||||||||||| || |||||||||||||||||||| ||||| |
|
|
| T |
23306 |
cttcatcactttcttccctcggcatcgtaaaaggcgacgtcgtctccgtcctctctcccaacactccggccatgtacgagct |
23387 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University