View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12633_low_12 (Length: 215)
Name: NF12633_low_12
Description: NF12633
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12633_low_12 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 76; Significance: 3e-35; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 89 - 199
Target Start/End: Complemental strand, 2567874 - 2567766
Alignment:
| Q |
89 |
ataaataaatgcaatattacacatgcttattcatatctatatatccacaatgtaaccnnnnnnnntctatatatccacaaacaatccatatatccacagt |
188 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
2567874 |
ataaataaatgcaatattaca--tgcttattcatatctatatatccacaatgtaaccaaaaaaaatctatatatccacaaacaatccatatatccacagt |
2567777 |
T |
 |
| Q |
189 |
gttacaattac |
199 |
Q |
| |
|
||||||||||| |
|
|
| T |
2567776 |
gttacaattac |
2567766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 17 - 73
Target Start/End: Complemental strand, 2567914 - 2567858
Alignment:
| Q |
17 |
gtcctatgaatatgatagctccacacaagataattacaatataaataaatgcaatat |
73 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2567914 |
gtcctatgaatatgatagctccacacaagataattacaatataaataaatgcaatat |
2567858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University