View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12634_high_21 (Length: 254)
Name: NF12634_high_21
Description: NF12634
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12634_high_21 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 18 - 254
Target Start/End: Complemental strand, 34252999 - 34252764
Alignment:
| Q |
18 |
gttagatgttgctcgttcatatataaagccgcatacttctgatgacgagaatgataaggcatcttcgccccctgcggcaactttggaaaattaatttttc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34252999 |
gttagatgttgctcgttcatatataaagccgcatacttctgatgacgagaatgataaggcatcttcgccccctgcggcaactttggaaaattaatttttc |
34252900 |
T |
|
| Q |
118 |
tgtgtaaccttagattaggactttgttggtctgtgcaatattgtaacgttccttctcttaagttatttatttattcttgcaacacagcggcccaaagtca |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||| || |
|
|
| T |
34252899 |
tgtgtaaccttagattaggactttgttggtctgtgcaatattgtaactttccttctcttaagttatttatttattcttgcaacacagc-gcccaaagcca |
34252801 |
T |
|
| Q |
218 |
tgtatatttattttgatgcacagttggtttttgtctt |
254 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34252800 |
tgtatatttattttgatgcacagttggtttttgtctt |
34252764 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University