View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12634_high_22 (Length: 241)
Name: NF12634_high_22
Description: NF12634
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12634_high_22 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 77; Significance: 7e-36; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 114 - 210
Target Start/End: Original strand, 46308816 - 46308912
Alignment:
| Q |
114 |
atttactatcaacttgaattgaaaaagcaataaagaaataagtgtcataatcagtttaaaattacatgacaacgcactcactttcacaaaatttctg |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||| ||||| |||||||||||||||||| |||| |
|
|
| T |
46308816 |
atttactatcaacttgaattgaaaaagcaataaagaaataagtgtcatgatgagtttaaaattacataacaacacactcactttcacaaaatctctg |
46308912 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 54 - 116
Target Start/End: Original strand, 46306899 - 46306961
Alignment:
| Q |
54 |
ttttaaacaaataagaagcaaaagggtgagtttattttaatacggctgaaagaagtgcatatt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
46306899 |
ttttaaacaaataagaagcaaaagggtgagtttattttcatacggctgaaagaagtacatatt |
46306961 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 118 - 201
Target Start/End: Complemental strand, 46015103 - 46015021
Alignment:
| Q |
118 |
actatcaacttgaattgaaaaagcaataaagaaataagtgtcataatcagtttaaaattacatgacaacgcactcactttcaca |
201 |
Q |
| |
|
|||||||||| ||||||||||||||| ||| |||||| ||||| | |||||||||||||||||||| |||||| ||||||| |
|
|
| T |
46015103 |
actatcaactagaattgaaaaagcaacaaa-aaataaaagtcatgaagagtttaaaattacatgacaagacactcaatttcaca |
46015021 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 54 - 105
Target Start/End: Original strand, 3801527 - 3801578
Alignment:
| Q |
54 |
ttttaaacaaataagaagcaaaagggtgagtttattttaatacggctgaaag |
105 |
Q |
| |
|
|||||||||||||||||| ||||||||| ||| ||||||||| |||||||| |
|
|
| T |
3801527 |
ttttaaacaaataagaagtgaaagggtgaatttcttttaatacagctgaaag |
3801578 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University