View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12634_high_29 (Length: 229)
Name: NF12634_high_29
Description: NF12634
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12634_high_29 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 1 - 219
Target Start/End: Complemental strand, 34252748 - 34252525
Alignment:
| Q |
1 |
taacttgctctatatagtgtttccaccattgttcttgaaatatttatatgaaaataaaaaattatttattgtcatttgttttattcttcgtatccaattt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34252748 |
taacttgctctatatagtgtttccaccattgttcttgaaatgtttatatgaaaataaaaaattatttattgtcatttgttttattcttcgtatccaattt |
34252649 |
T |
 |
| Q |
101 |
tccgcttaagacaagccatcatattgactacat---atcacttctgttgtataagaattggct--tgtcttactgagcgtttgtggaggttttgtcttga |
195 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||| |
|
|
| T |
34252648 |
tccgtttaagacaagccatcatattgactacatatcatcacttctgttgtataagaattgggttgtgtcttactgagcgtttgtggaggttttgtcttga |
34252549 |
T |
 |
| Q |
196 |
atattgtcctgccactttgtgatg |
219 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
34252548 |
atattgtcctgccactttgtgatg |
34252525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University