View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12634_low_12 (Length: 372)
Name: NF12634_low_12
Description: NF12634
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12634_low_12 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 172; Significance: 2e-92; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 187 - 358
Target Start/End: Complemental strand, 34219402 - 34219231
Alignment:
| Q |
187 |
cacttgggaaggtccatgtgagatcatttgtcagaacaaggttcgttttgatggatgttgacataaaattacgtggaccaacaaaaatataagaacatta |
286 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34219402 |
cacttgggaaggtccatgtgagatcatttgtcagaacaaggttcgttttgatggatgttgacataaaattacgtggaccaacaaaaatataagaacatta |
34219303 |
T |
 |
| Q |
287 |
attatggtccctagttatcctttcttttacatgccttagtgtgtgacaccgcccatctaaaactcaccatcc |
358 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34219302 |
attatggtccctagttatcctttcttttacatgccttagtgtgtgacaccgcccatctaaaactcaccatcc |
34219231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 101; E-Value: 6e-50
Query Start/End: Original strand, 16 - 116
Target Start/End: Complemental strand, 34219573 - 34219473
Alignment:
| Q |
16 |
caatgagatatgaaaatagttagttattcccgcatgcaaggtcgcattcttaatcgacatcacaaaggtcttgcttgaatcacatgaagtttatgatgtt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34219573 |
caatgagatatgaaaatagttagttattcccgcatgcaaggtcgcattcttaatcgacatcacaaaggtcttgcttgaatcacatgaagtttatgatgtt |
34219474 |
T |
 |
| Q |
116 |
c |
116 |
Q |
| |
|
| |
|
|
| T |
34219473 |
c |
34219473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University