View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12634_low_19 (Length: 322)
Name: NF12634_low_19
Description: NF12634
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12634_low_19 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 1 - 274
Target Start/End: Complemental strand, 21710997 - 21710728
Alignment:
| Q |
1 |
tgtaatttgaaaattttagtttttccagataaaatgcatgtgactagaaaatggtttcatgatactcttgtagtgataaactttgcagttacatcatagt |
100 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||| ||||||||| |||||||||||||||||||||| ||||||| || |||||||||||| |
|
|
| T |
21710997 |
tgtaatttgaaaattttagttttgccagataaaatgcatgtgagtagaaaatgttttcatgatactcttgtagtgagaaacttttcatttacatcatagt |
21710898 |
T |
|
| Q |
101 |
atttttccgtaatttaattctgtggatgcgctagctattgagggatcatgtgataaaacagatgaacttctaaaccaaaatatcagttagttcccacaaa |
200 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| |||||||||| ||| ||||||||||||||||||||||||||||||| |||||||||||| || |
|
|
| T |
21710897 |
atttttctgtaatttaattctgtggatgcgcta----ttgagggatcgtgtcataaaacagatgaacttctaaaccaaaatattggttagttcccacgaa |
21710802 |
T |
|
| Q |
201 |
tgtggaggattgtttgaactttgaatgatgtacatattatttttaaagttgcaatgttttattttattgcacca |
274 |
Q |
| |
|
||| | |||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||| |
|
|
| T |
21710801 |
tgtcggggattgtttgaactttgaatgatgtacatattctttttaaacttgcaatgttttattttattgcacca |
21710728 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University