View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12634_low_21 (Length: 279)
Name: NF12634_low_21
Description: NF12634
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12634_low_21 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 50; Significance: 1e-19; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 113 - 162
Target Start/End: Original strand, 20977095 - 20977144
Alignment:
| Q |
113 |
cgagtttgttaaggttttagtcaaagattttggtcttgttatcttgtcgt |
162 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20977095 |
cgagtttgttaaggttttagtcaaagattttggtcttgttatcttgtcgt |
20977144 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 13 - 56
Target Start/End: Original strand, 20977003 - 20977046
Alignment:
| Q |
13 |
gttcactggtgagtttaagaatcattctaattcttcaaacgaag |
56 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
20977003 |
gttctctggtgagtttaagaatcattctaattcttcaaatgaag |
20977046 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University