View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12634_low_21 (Length: 279)

Name: NF12634_low_21
Description: NF12634
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12634_low_21
NF12634_low_21
[»] chr5 (2 HSPs)
chr5 (113-162)||(20977095-20977144)
chr5 (13-56)||(20977003-20977046)


Alignment Details
Target: chr5 (Bit Score: 50; Significance: 1e-19; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 113 - 162
Target Start/End: Original strand, 20977095 - 20977144
Alignment:
113 cgagtttgttaaggttttagtcaaagattttggtcttgttatcttgtcgt 162  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||    
20977095 cgagtttgttaaggttttagtcaaagattttggtcttgttatcttgtcgt 20977144  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 13 - 56
Target Start/End: Original strand, 20977003 - 20977046
Alignment:
13 gttcactggtgagtttaagaatcattctaattcttcaaacgaag 56  Q
    |||| |||||||||||||||||||||||||||||||||| ||||    
20977003 gttctctggtgagtttaagaatcattctaattcttcaaatgaag 20977046  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University