View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12634_low_29 (Length: 235)
Name: NF12634_low_29
Description: NF12634
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12634_low_29 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 139; Significance: 7e-73; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 13 - 155
Target Start/End: Complemental strand, 25996268 - 25996126
Alignment:
| Q |
13 |
cttttcttttatatgctcgttttgactagtgtcttggtgtcgaggcatgtaatttaatgtgacaaaggagtagtcctgtacaaataaaagagcttttata |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
25996268 |
cttttcttttatatgctcgttttgactagtgtcttggtgtcgaggcatgtaatttaatgtgacaaaggagtagtcgtgtacaaataaaagagcttttata |
25996169 |
T |
 |
| Q |
113 |
taggtaccttccaattttccaacacatatttaacacctcattt |
155 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25996168 |
taggtaccttccaattttccaacacatatttaacacctcattt |
25996126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University