View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12636_high_2 (Length: 252)
Name: NF12636_high_2
Description: NF12636
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12636_high_2 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 1 - 241
Target Start/End: Original strand, 45440704 - 45440948
Alignment:
| Q |
1 |
agctaagtagagaacataactaactgcgttattataacataaaaaacactcccggcttcaatgatgatacctctaaagtgagctgaaagtttttcacgga |
100 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45440704 |
agctaagtagacaacataactaactgcgttattataacataaaaaacactcccggcttcaatgatgatacctctaaagtgagctgaaagtttttcacgga |
45440803 |
T |
|
| Q |
101 |
tctctggattccaagtcctggccttcctttatctctatagtcaagctcaaattgctttgtactcttgatgaaggaagacaataaaaatgaatgaaaatca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
45440804 |
tctctggattccaagtcctggccttcctttatctctatagtcaagctcaaattgctttgtactcttgatgaaggaagacaataaaaattaatgaaaatca |
45440903 |
T |
|
| Q |
201 |
atatccatggctagtt----ataaatgacaaagaaacttcccctc |
241 |
Q |
| |
|
|||||||||||||| | ||||||||||||||||||||||||| |
|
|
| T |
45440904 |
atatccatggctagctataaataaatgacaaagaaacttcccctc |
45440948 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University