View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12636_low_3 (Length: 278)
Name: NF12636_low_3
Description: NF12636
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12636_low_3 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 243; Significance: 1e-135; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 18 - 260
Target Start/End: Complemental strand, 45440507 - 45440265
Alignment:
| Q |
18 |
tggttaccaggcgttttgcatatgtttggcttccattgatgcaaagctttgttgcatagtgtagcggcaaatctctctgttcccaccattggttcaacct |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45440507 |
tggttaccaggcgttttgcatatgtttggcttccattgatgcaaagctttgttgcatagtgtagcggcaaatctctctgttcccaccattggttcaacct |
45440408 |
T |
|
| Q |
118 |
ctgaactcaagatctcttctgtttcgcccagccccatccagaaagaagtcttggaatttatttgcccaagttagtgaagcttttgtctgagtacattttt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45440407 |
ctgaactcaagatctcttctgtttcgcccagccccatccagaaagaagtcttggaatttatttgcccaagttagtgaagcttttgtctgagtacattttt |
45440308 |
T |
|
| Q |
218 |
caacagaaaaatgaaaattttggagttgtatttggtgtgtcta |
260 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45440307 |
caacagaaaaatgaaaattttggagttgtatttggtgtgtcta |
45440265 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 97 - 257
Target Start/End: Complemental strand, 45439841 - 45439682
Alignment:
| Q |
97 |
ttcccaccattggttcaacctctgaactcaagatctcttctg-tttcgcccagccccatccagaaagaagtcttgg-aatttatttgcccaagttagtga |
194 |
Q |
| |
|
||||||| ||| |||||||||||||||| ||| | |||||| ||||||||| |||||||||||||| ||| | || |||||| ||||||| | ||| |
|
|
| T |
45439841 |
ttcccacaattagttcaacctctgaactaaagttagcttctggtttcgcccaataccatccagaaagaacgctttgcaaattatttacccaagt-attga |
45439743 |
T |
|
| Q |
195 |
agcttttgtctgagtacatttttcaacagaaaaatgaaaattttggagttgtatttggtgtgt |
257 |
Q |
| |
|
| ||||||||||||||||||||||| ||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
45439742 |
a--ttttgtctgagtacatttttcaaaagaaaaatgaagattttggacttgtatttggtgtgt |
45439682 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University