View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12636_low_4 (Length: 257)
Name: NF12636_low_4
Description: NF12636
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12636_low_4 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 26 - 239
Target Start/End: Complemental strand, 34353777 - 34353573
Alignment:
| Q |
26 |
attcaatgtaaaccttttactcatactaataccaacatttttagtttcatatccggtttcaactttcagaattgagacctggannnnnnngcactcaaac |
125 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
34353777 |
attcaatggaaaccttttactcatactaataccaacatttttagtttcatatccggtttcaactttcagaattgagacctggatttttttgcactcaa-- |
34353680 |
T |
|
| Q |
126 |
cactcaaggcattaaattatatctagactttacatcttagttctttatatctctcataagtcttaacttgaagggaattatccttcaaaggctcatgact |
225 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34353679 |
-------ggcattaaattatatctagaatttacatcttagttctttatatctctcataagtcttaacttgaagggaattatccttcaaaggctcatgact |
34353587 |
T |
|
| Q |
226 |
tgctaagtaatggc |
239 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
34353586 |
tgctaagtaatggc |
34353573 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University