View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12637_low_19 (Length: 340)
Name: NF12637_low_19
Description: NF12637
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12637_low_19 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 310; Significance: 1e-174; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 310; E-Value: 1e-174
Query Start/End: Original strand, 18 - 327
Target Start/End: Original strand, 43546823 - 43547132
Alignment:
| Q |
18 |
gtaattcctacaatcaacctcagtaaagccaactttgctgataccaccatactctttgatgagtgcagacataattcggcgaggacccataccagcagcc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43546823 |
gtaattcctacaatcaacctcagtaaagccaactttgctgataccaccatactctttgatgagtgcagacataattcggcgaggacccataccagcagcc |
43546922 |
T |
 |
| Q |
118 |
tgtagagtgtcaattagggtttttgcagaaccagaaatttgcctgtgggaacgaaggcagtgaacctgatcgggtggaacaagttcgtgattgtgttctc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43546923 |
tgtagagtgtcaattagggtttttgcagaaccagaaatttgcctgtgggaacgaaggcagtgaacctgatcgggtggaacaagttcgtgattgtgttctc |
43547022 |
T |
 |
| Q |
218 |
tgacgaagccggatacgatccacttggcagaagaatcgtgcattttgacagataaagaggctttgcatccaaccctagtgactgttcgtgggcgtttgat |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43547023 |
tgacgaagccggatacgatccacttggcagaagaatcgtgcattttgacagataaagaggctttgcatccaaccctagtgactgttcgtgggcgtttgat |
43547122 |
T |
 |
| Q |
318 |
ctctctgtct |
327 |
Q |
| |
|
|||||||||| |
|
|
| T |
43547123 |
ctctctgtct |
43547132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University