View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12637_low_38 (Length: 239)
Name: NF12637_low_38
Description: NF12637
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12637_low_38 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 103; Significance: 2e-51; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 19 - 213
Target Start/End: Original strand, 33431253 - 33431448
Alignment:
| Q |
19 |
tacatataaagttaataaaatttaaattttggtgaatttgactttttatactcatgattttgttgttgttaactatccggttcataggagaaggagactt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||| | |||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
33431253 |
tacatataaagttaataaaatttaaattcctgtgaatttgactttttatactcgtaattttgttgttgttaactatccggtttataggagaaggagactt |
33431352 |
T |
|
| Q |
119 |
cacnnnnnnnnnnnnnnntaagagaaggaga-tgtgataatttagactttgatgaagaggtaattaaaacatactccatccatcccgaaatataag |
213 |
Q |
| |
|
||| ||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||| ||| || ||||||||||| |
|
|
| T |
33431353 |
caccaaaaaaattaaaaataagagaaggagactgtgataatttagactttgatcaagaggtaattaaaacatactccctccgtctcgaaatataag |
33431448 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University