View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12638_low_3 (Length: 258)
Name: NF12638_low_3
Description: NF12638
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12638_low_3 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 18 - 250
Target Start/End: Complemental strand, 26123173 - 26122941
Alignment:
| Q |
18 |
atggttttcattcttgttttatgacccctagagtatctgagtatctatgtttatagataaaattgtgccttatattgactattcataaataatagatttc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26123173 |
atggttttcattcttgttttatgacccctaaagtatctgagtatctatgtttatagataaaattgtgccttatattgactattcataaataatagatttc |
26123074 |
T |
 |
| Q |
118 |
aaaggtttctgcaatgaccattcaaaaatattagtattcaattaataatatgattttaatacatcccttgtgttggttttgtgcatgcgaatgtgccttt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||| |
|
|
| T |
26123073 |
aaaggtttctgcaatgaccattcaaaaatatttgtattcaattaataatatgattttaatacatctctcgtgttggttttgtgcatgcgaatgtgccttt |
26122974 |
T |
 |
| Q |
218 |
cctttgaatttgaatcccaaagtcagtgaacga |
250 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| |
|
|
| T |
26122973 |
actttgaatttgaatcccaaagttagtgaacga |
26122941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University