View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12638_low_5 (Length: 219)
Name: NF12638_low_5
Description: NF12638
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12638_low_5 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 19 - 189
Target Start/End: Original strand, 43939032 - 43939202
Alignment:
| Q |
19 |
ctccatacacaatcctgcttgctatcaccactagtttctccactgtgcttggtgacagatagttcaacaaaaccccaccataatacatcatatccctaga |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43939032 |
ctccatacacaatcctgcttgctatcaccactagtttctccactgtgcttggtgacagatagttcaacaaaaccccaccataatacatcatatccctaga |
43939131 |
T |
|
| Q |
119 |
aagaatatgaacctacatgtacataacaatacattattgcacaagttgagtagataaattccattttgatc |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43939132 |
aagaatatgaacctacatgtacataacaatacattattgcacaagttgagtagataaattccattttgatc |
43939202 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University