View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12638_low_6 (Length: 203)
Name: NF12638_low_6
Description: NF12638
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12638_low_6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 10 - 154
Target Start/End: Complemental strand, 39979450 - 39979306
Alignment:
| Q |
10 |
gaggaggagcacagaacattctagtaaattgtaatctctgccattaaaccaataaagttgtgaatttgccattttctaatgccattgtgatttgtgaagc |
109 |
Q |
| |
|
|||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39979450 |
gaggagcagaacagaacattctagtaaattgtaatctctgccattaaaccaataaagttgtgaatttgccattttctaatgccattgtgatttgtgaagc |
39979351 |
T |
 |
| Q |
110 |
catgctagtccatcatcgactaaattgtgaaaattctgatgagct |
154 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39979350 |
catgctagtccatcatcgactaaattgtgaaaattctgatgagct |
39979306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University