View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12639_high_2 (Length: 268)
Name: NF12639_high_2
Description: NF12639
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12639_high_2 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 182; Significance: 2e-98; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 18 - 207
Target Start/End: Complemental strand, 55023269 - 55023080
Alignment:
| Q |
18 |
cagagatgttggtccctaattgtgtgaagtggtgttactcccctaaatgtatcgaaaatgcaaaaacatggttgaatgtgtcttttgttagtaagctcat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55023269 |
cagagatgttggtccctaattgtgtgaagtggtgttactcccctaaatgtatcgaaaatgcaaaaacatggttgaatgtgtcttttgttagtaagctcat |
55023170 |
T |
|
| Q |
118 |
atagaccaaactaaccaacaaaacacacattcatgtacgatgttgtagttttgatacattcatagactataataacaactattcacaaat |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
55023169 |
atagaccaaactaaccaacaaaacacacattcatgtacgacgttgtagttttgatacattcatagactataacaacaactattcacaaat |
55023080 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 204 - 240
Target Start/End: Complemental strand, 55023069 - 55023033
Alignment:
| Q |
204 |
aaatgactatttactctttaatttaagagtgaattaa |
240 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
55023069 |
aaatgactacttactctttaatttaagagtgaattaa |
55023033 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University